Anti-KMT1A / SUV39H1抗体[44.1] (ab12405)

Thank you for your enquiry. This antibody was tested for its capacity to immunoprecipitate chromatin here at Abcam. Our laboratory team were responsible for the design and execution of the experiments. I have been in touch with them and the definitions and primer sequences for the SAT regions are as follows. "SAT2" - Accession number X72623 Chr1 hSat2 repeat - F ATCGAATGGAAATGAAAGGAGTCA Chr1 hSat2 repeat - R GACCATTGGATGATTGCAGTCA "SATa" - Accession number M26919 Chr1 hSat alpha - F AAGGTCAATGGCAGAAAAGAA Chr1 hSat alpha - R CAACGAAGGCCACAAGATGTC I hope that this information helps. Please do not hesitate to contact me should you require further assistance.

I would like to recommend trying a fixation with ice cold methanol or acetone for 10min and adding triton x100 (0.1%) in the dilution buffer of both primary and secondary antibodies. If you still have problems with this antibody in ICC and WB please let me know and I will arrange for a replacement antibody to be sent to you,

I'm sorry to hear you are having problems with ab12405 both in WB and in IHC. For the WB problem, I would like to suggest using a nuclear extract of your cells rather than a whole cell extract as the protein is nuclear. You did not mention the incubation time with the primary antibody, please make sure you incubate overnight at 4C. We have a protocol for histone western blotting that you may want to take a look at, I enclose it here: is protocol refers to western blot detection of Histone proteins derived from purified calf thymus. Please note that protein loadings derived from cellular lysates will need to be determined empirically. For each gel lane between 1-2 mg of total Histone protein solution in 1x sample buffer should prove sufficient. The choice of sample buffer will vary depending on the type of gel used (i.e. Tris / glycine or Tris / Tricine SDS PAGE). N.B. A higher percentage gel such as 10-20% Tricine SDS-polyacrylamide is recommended for effective resolution of Histone proteins The sample should be supplemented with 5% (v/v) b-mercaptoethanol and heated to around 95°C for 5 min. The sample should be centrifuged briefly to restore sample volume from condensation formation in the eppendorf during heating. Load the protein samples onto the appropriate SDS-polyacrylamide gel and run the gel under standard conditions. NB it is advisable not to run the dye front completely off the gel when dealing with smaller protein resolutions. For protein transfer from the gel please refer to the protocols supplied with your transfer apparatus, as these will vary depending upon the method of transfer employed i.e. semi-dry blotting or wet blotting. N.B. Nitrocellulose membranes with a pore size of 0.2 mm are recommended for optimal retention of Histone proteins. Transfer times between 30 min and 90 min should prove sufficient for effective protein transfer. Visualise equivalent protein loadings using Ponceau staining Block the membranes by adding an appreciable volume of blocking buffer (5% (w/v) BSA, 0.5% (v/v) Tween-20 in TBS or PBS as preferred). Incubate for 1 h at room temperature by gentle rotation. Dilute the primary antibody in blocking buffer as suggested in the datasheet protocols and incubate the blots overnight at 4°C with gentle rotation. N.B. If you wish to perform blocking peptide studies then a final concentration of between 0.1 and 1.0 mg/ml peptide should be pre-incubated with the antibody for around 20 min at room temperature before the blots are added. Rinse the blots briefly in PBS or TBS then perform two 5 min washes in blocking buffer. Prepare the relevant secondary antibody conjugate in blocking buffer and incubate the blots for 1 h at room temperature with gentle rotation. Wash the blots with three 5 min washes in blocking buffer and then perform a final rinse in PBS or TBS. Perform ECL, ECF or infrared detection as described by the manufacturer. Top Tips for Successful Western blotting with our range of Histone antibodies. · Use a high percentage gel for clear resolution of Histone proteins. · Use nitrocellulose membrane with a pore size of 0.2 mm to ensure optimal capture of Histone proteins. · Use high quality BSA in your blocking solutions rather than conventional dried milk such as Marvel. We also recommend HeLa nuclear extract as a positive control, you may wish to try this in parallel. If you still have a problem do not hesitate to contact us again,