Application
ChIP
Sample
Human Cell lysate - whole cell (Raji)
Specification
Raji
Type
Cross-linking (X-ChIP)
Duration of cross-linking step: 10 minute(s) and 0 second(s)
Specification of the cross-linking agent: Formaldehyde
Duration of cross-linking step: 10 minute(s) and 0 second(s)
Specification of the cross-linking agent: Formaldehyde
Detection step
Real-time PCR
Positive control
Primer set for tRNA-Leu 5'-GTC AGG ATG GCC GAG TCT AAG-3' and 5'-CCA CGC CTC CAT ACG GAG AAC CAG AAG ACC C-3' from Johnson, S.S. et al Molecular Cell
Negative control
IgG and primer set for Alu on Chromosome 10 5’GATTCTCAACAGCAGAATTCCATGCC3’ and 5’CATGTTTGAGAATGTCTACTTCTTAG3’ from Zeng, W. et al 2009 PLOS Genetics
Other product details
Incubation time
12 hour(s) and 0 minute(s) · Temperature: 4°C
Additional data
Additional Notes
Cross-linked nuclei were purifed and the DNA was fragmented by MNase digestion. IPs used magnetic ProtA/G beads.
The reviewer received a reward from Abcam’s Loyalty Program in thanks for submitting this Abreview and for helping the scientific community make better-informed decisions.
Abcam user community
Verified customer
提交于 Jan 16 2012